File name,Spreadsheet tab,Element or value display name,Description,Data type,Character length,Acceptable values,Required?,Accepts null values?,Missing data value,Forward primer sequence,Reverse primer sequence,Associated gene or QTL,Chromosome (Glycine max),Associated pathogen
Table 3 - JTN-5110 compared to 5601T.csv,n/a,Location,"Field location in Milan, TN (Milan) or Jackson, TN (WTREC)",varchar,5,Milan|WTREC,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,Year,Year that field test was conducted (yyyy),date,4,2010-2013|2015|2016,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,Experiment Name,"Includes 2-digit year, location, and maturity group (MG)",varchar,30,n/a,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,Plot,Field plot number,integer,4,0000-9999,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,Block,Replication,integer,4,1|2|3|4,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,Entry,Entry number,integer,4,0-99,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,Name,"Name of genotype, line, or cultivar",varchar,30,n/a,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,Pedigree,"Female by male parent of gentype, line, or cultivar listed in the Name column",varchar,60,n/a,n,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,HEIGHT_IN,Height of soybean plant at maturity in inches,integer,4,0-99,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,HEIGHT_CM,Height of soybean plant at maturity in centimeters,integer,4,0-200,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,LODGING,"Lodging rated according to a scale of 1–5, where 1 = no lodging, 5 = all lodged.",integer,4,1|2|3|4|5,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,YLD_BUACRE,Seed yield in bushels per acre,double,5,0-150,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,YLD_KGHA,Seed yield in kilograms per hectare,double,7,0-9000,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,SEED_SIZE,Weight in grams of 100 seed,double,5,0-100,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 3 - JTN-5110 compared to 5601T.csv,n/a,QUALITY,"Seed quality rated according to a scale of 1–5, where 1 = very good, 5 = very poor.",integer,4,1|2|3|4|5,n,y,-999,n/a,n/a,n/a,n/a,n/a
Table 5 - compiled marker data.csv,n/a,Year Description,Extended description of when screening was conducted,varchar,30,n/a,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 5 - compiled marker data.csv,n/a,Simple Year,Year of screening (yyyy),date,4,2005-2020,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 5 - compiled marker data.csv,n/a,Genotype,"Name of genotype, line, or cultivar",varchar,30,n/a,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 5 - compiled marker data.csv,n/a,Sample ID,Name of sample used in screening corresponding to year and genotype,varchar,30,n/a,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 5 - compiled marker data.csv,n/a,Satt309,"Reaction of SSR marker Satt309 where: R, allele matches that of resistant Hartwig; and S, allele does not match that of resistant Hartwig",varchar,4,"R|S|R,S",n,y,-999,GCGCCTTCAAATTGGCGTCTT,GCGCCTTAAATAAAACCCGAAACT,rhg1,18,Heterodera glycines
Table 5 - compiled marker data.csv,n/a,Sat_168,"Reaction of SSR marker Sat_168 where: R, allele matches that of resistant Hartwig; and S, allele does not match that of resistant Hartwig",varchar,4,"R|S|R,S",n,y,-999,TGTGGATAAAAGAGCATTCAAAATG,GCGATCCTTGTTTATCTCAAAAAAGTGT,rhg1,18,Heterodera glycines
Table 5 - compiled marker data.csv,n/a,Sat_162,"Reaction of SSR marker Sat_162 where: R, allele matches that of resistant Hartwig; and S, allele does not match that of resistant Hartwig",varchar,4,"R|S|R,S",n,y,-999,GCGTGGTTTTTCGCTGGATATA,GCGCATTTCGTAACATATTTTTCAC,Rhg4,8,Heterodera glycines
Table 5 - compiled marker data.csv,n/a,Satt574,"Reaction of SSR marker Satt574 where: R, allele matches that of resistant Hartwig; and S, allele does not match that of resistant Hartwig",varchar,4,"R|S|R,S",n,y,-999,GCGCCTCTCATATGGTAT,GCGGGGGGGAAATGTAGA,cqSCN-005,17,Heterodera glycines
Table 7 - frogeye leafspot evaluation.csv,n/a,Year,Year that field test was conducted (yyyy),date,4,2010-2013|2015|2016,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 7 - frogeye leafspot evaluation.csv,n/a,Control/Checks,"Name of genotype, line, or cultivar",varchar,30,n/a,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 7 - frogeye leafspot evaluation.csv,n/a,Description,"Indicates whether the genotype, line, or cultivar is a resistant (res) or susceptible (susc) check for frogeye leafspot or is a germplasm for screening",varchar,30,n/a,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 7 - frogeye leafspot evaluation.csv,n/a,MG,"Maturity group of the genotype, line, or cultivar",integer,1,3|4|5|6,n,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 7 - frogeye leafspot evaluation.csv,n/a,Replication,Replication,integer,1,1|2|3|4,y,n,n/a,n/a,n/a,n/a,n/a,n/a
Table 7 - frogeye leafspot evaluation.csv,n/a,Rating,"Presence of frogeye leafspot lesions on a scale of 0–9, where 0 = no disease and 9 = 90% of leaf area diseased",integer,4,0|1|2|3|4|5|6|7|8|9,n,y,-999,n/a,n/a,n/a,n/a,Cercospora sojina
